Identification of a natural soluble neuropilin-1 that binds vascular endothelial growth factor: In vivo expression and antitumor activity

Cell Culture and Animals.

AT2.1 and AT3.1 rat prostate carcinoma cells (11) were provided by Bruce Zetter (Children's Hospital, Boston) and grown in RPMI 1640 medium containing 10% FCS and l-glutamine/penicillin G/streptomycin sulfate (GPS) (Irvine Scientific). Human PC3 prostate carcinoma cells were provided by Michael Freeman (Children's Hospital) and grown in RPMI 1640/10% FCS/GPS. Chinese hamster ovary cells (CHO-K1) were obtained from American Type Culture Collection and cultured in F12 medium with 10% FCS/GPS. Porcine aortic EC expressing NRP1 (PAE-NRP1) and both NRP1 and KDR (PAE/NRP1/KDR) have been described previously (4). Pathogen-free male Copenhagen rats were purchased from Charles River Laboratories and used at 10 weeks of age.

Northern Blot Analysis.

Poly(A)⁺ RNA preparation, RNA gel electrophoresis, blotting, and hybridization were performed as described (12). Probes were made from PCR products corresponding to the entire human a/CUB (754 bp), b/factor V/VIII (950 bp), and c/MAM (488 bp) NRP1 domains (13) and amplified by using the following primers, respectively: 5′a, TTCGCAACGATAAATGTGGCG; 3′a, GAAATCTTCTGAGACACTGC; 5′b, GAAGATTTCAAATGTATGGAAG; 3′b, GGCTTCCACTTCACAGCCCAG; 5′c, GGTTTTAACTGTGAATTTGG; 3′c, ACAATCTTCTTGTGAAATGTG.

An oligonucleotide (TTCTGTCACATTTCGTATTTTATTTGATACTTTTTCG) that was complementary to the sNRP1 intron-derived sequence was also used as a probe by using the 3DNA Probe ³²P kit (Genisphere, Oakland, NJ).

Human sNRP1 cDNA Cloning.

A natural, soluble NRP1 cDNA was cloned by 3′ RACE (rapid amplification of cDNA ends) as described previously (12). First-strand oligo(dT)-primed cDNA was synthesized from 2 μg of PC3 mRNA, and PCR was performed by using primers 5′b and BamHI-dT (CCCTTCGGATCCTAACCTTTTTTTTTTTTTTTTT); a secondary PCR was performed by using the first PCR as template and primers 5′b2 (GAAGTATACGGTTGCAAGATA) and BamHI (CCCTTCGGATCCTAACC). A 700-bp PCR product was cloned by using the TOPO TA Cloning kit (Invitrogen). The 3′ cDNA clone sequence was identified as a truncated NRP1 (sNRP1) cDNA.

Expression Vectors.

The complete sNRP1 cDNA subsequently was cloned by PCR from the PC3 cDNA reaction and ligated into the pcDNA3.1 mammalian expression vector (Invitrogen). This sNRP1-pcDNA3.1 plasmid consisted of the entire 1,932-bp ORF and included the first 16 of 28 bp of intron-derived sequence at the 3′ end. For purification purposes, an H/m-sNRP1-pcDNA3.1 plasmid was constructed that contained His and c-Myc domain tags (HHHHHHQQKLISQQNL) between P³⁶ and G³⁷.

Immunoblot Analysis.

Cell lysates and serum-free conditioned medium (CM) were adjusted to 0.5 M NaCl/1 mM MnCl₂/1 mM CaCl₂ and incubated with 75 μl of 50% wt/vol Con A Sepharose beads (Amersham Pharmacia) overnight at 4°C with rotation. Con A beads were washed three times in 0.5 M NaCl/20 mM Tris, pH 7.5, and once in 50 mM NaCl/20 mM Tris, pH 7.5. Con A-binding proteins were separated by 7.5% SDS/PAGE and transferred to 0.45-μm Protran nitrocellulose membranes (Schleicher & Schuell). Membranes were incubated with 1:500 dilutions of either a rabbit polyclonal antibody (41-1), immunoreactive against amino acids 22-41 near the N terminus of human NRP1, or a goat polyclonal antibody (C-19) immunoreactive against the C-terminal 19 aa of NRP1 (Santa Cruz Biotechnology). Horseradish peroxidase-conjugated secondary anti-rabbit IgG (Roche Diagnostics, Indianapolis, IN) and monoclonal anti-goat IgG (Sigma) were used at a 1:5,000 dilution, and blots were developed by using an enhanced chemiluminescence kit (NEN).

Synthesis and Purification of Recombinant sNRP1 Protein.

The H/m-sNRP1-pcDNA3.1 plasmid was transfected into Chinese hamster ovary (CHO-K1) cells by using Lipofectamine Reagent (Life Technologies, Gaithersburg, MD). A G418-resistant, sNRP1-expressing clone, as determined by Western blot with the 41–1 antibody, was expanded and used to condition 3 liters of serum-free medium. CM was concentrated by using an Amicon filter (Millipore), adjusted to 20 mM Tris, pH 7.5/0.5 M NaCl/1 mM MnCl₂/1 mM CaCl₂ (Con A-binding buffer), and incubated with 5 ml of 50% vol/vol Con A beads overnight at 4°C. The beads were washed with Con A-binding buffer. Con A-binding proteins were eluted with 20 mM Tris, pH 7.5/50 mM NaCl/0.2 M methyl α-d-mannopyranoside at 25°C for 1 hr and applied onto a 1-ml HiTrap chelating column loaded with cobalt and attached to a Pharmacia FPLC system. The column was washed with 20 mM Hepes, pH 7.2/0.5 M NaCl. Bound proteins were eluted by a linear gradient of 5–150 mM imidazole at a 0.5 ml/min flow rate. Fractions were analyzed for the presence of sNRP1 by Western blot analysis and Coomassie blue staining of SDS/PAGE. Pooled sNRP1 fractions were concentrated and adjusted to 20 mM Hepes, pH 7.2/50 mM NaCl.

Binding of ¹²⁵I-VEGF₁₆₅ to sNRP1 and to Cells.

Tyrosine Phosphorylation of KDR.

PAS/NRP1/KDR cells were grown in 10-cm plates to 80% confluence and serum-starved overnight in F12 medium supplemented with 0.1% BSA. Cells were treated with 5 ng/ml VEGF₁₆₅ with and without 1 μg/ml sNRP1 for 10 min, washed with ice-cold PBS, and lysed in 1.2 ml of buffer, which contained 20 mM sodium phosphate (pH 7.2), 1% Triton X-100, 50 mM NaCl, 250 mM sucrose, 2 mM EDTA, 1 mM sodium orthovanadate, 10 mM NaF, 5 mM sodium pyrophosphate, and a mixture of protease inhibitors. Cell lysates were precleared by incubation with 40 μl of protein G-Sepharose (50% vol/vol slurry) for 1 hr at 4°C and incubated overnight with 1 μg of polyclonal anti-KDR antibodies (Santa Cruz Biotechnology). The immune complexes were incubated with 40 μl of protein G-Sepharose (50% vol/vol slurry) for 1.5 hr at 4°C, washed four times with lysis buffer, and boiled in 2× Laemmli's sample buffer. Proteins were resolved on 7% SDS/PAGE and analyzed by Western blot by using monoclonal antiphosphotyrosine antibodies (16).

In Situ Hybridization Analysis (ISH).

ISH was performed as described (17, 18) with biotinylated oligonucleotide probes (Research Genetics, Huntsville, AL). The biotinylated probes used were an antisense sNRP1-specific oligonucleotide complementary to the 28-nt, intron-encoded 3′ mRNA (TTCTGTCACATTTCGTATTTTATTTGATAC) and a control sense oligonucleotide. After hybridization, slides were stained with Fast Red alkaline phosphatase substrate (Biomeda, Foster City, CA). An antisense NRP1-specific riboprobe was made from a 750-bp 3′ UTR cDNA fragment in Bluescript II KS(+) (Stratagene) by using a digoxigenin RNA-labeling kit (Boehringer Mannheim) and used in ISH as described (19). Slides were stained with BM Purple alkaline phosphatase substrate (Boehringer Mannheim). Probes were hybridized to slides of PC3 cells and NormalGrid:Multi-tissue Control Slides (Biomeda).

Transfection of sNRP1 into Tumor Cells and Tumor Growth In Vivo.

The sNRP1-pcDNA3.1 or pcDNA3.1 (neo) plasmids were transfected into AT2.1 or AT3.1 prostate carcinoma cells, and G418-resistant, sNRP1-expressing clones were isolated. Tumor cells [10⁶ cells/200 μl of Hanks' balanced salt solution (HBSS)] were injected into Copenhagen rats s.c. in the dorsal lateral flank proximal to the midline or orthotopically (10⁶ cells/40 μl of HBSS) into the prostate. Rats were monitored daily and sacrificed 3 weeks after tumor cell injection.

Immunohistochemistry.

Formalin-fixed, paraffin-embedded tissues were used for routine histology and immunohistochemistry to identify dividing proliferating cell nuclear antigen (PCNA)-positive cells and terminal deoxynucleotidyltransferase-mediated dUTP end labeling (TUNEL)-positive cells as described (20). The stained tumor slides were scanned by using a Polaroid Sprint Scan35 (Meyer Instruments) to obtain photographs of entire tumor sections.

Identification and Cloning of a 2.2-kb NRP1 Isoform Expressed by PC3 Cells.

Human NRP1 is expressed as a 7-kb mRNA transcript in adult cell lines and tissues (4). However, a shorter NRP1 mRNA doublet of 2.2–2.5 kb also was expressed in some cells and tissues, for example, human prostate carcinoma PC3 cells, heart, and placenta. NRP1 has an extracellular domain (13) consisting of complement (a/CUB), coagulation factor V/VIII (b), and MAM (c) homology subdomains (Fig. 1A). Northern blots using cDNA probes corresponding to the a/CUB (Fig. 1C, lane 1) and b/coagulation factor (Fig. 1C, lane 2) homology domains detected both 7-kb and 2.2- to 2.5-kb NRP1 mRNAs, whereas a probe corresponding to the c/MAM homology domain (Fig. 1C, lane 3) detected only 7-kb mRNA. These results suggested that the 2.2- to 2.5-kb mRNAs represent isoforms truncated in the extracellular domain. A 2,190-bp NRP1 cDNA was cloned from PC3 cells whose sequence predicted that it would encode a 644-aa truncated NRP1 isoform (Fig. 1B). The truncation occurs after NRP1 Ser⁶⁴¹, which is located in a linker region between the b/coagulation factor and c/MAM domains, and there are three additional novel amino acids, Gly⁶⁴²-Ile⁶⁴³-Lys⁶⁴⁴, at the C terminus. The truncated NRP1 cDNA has a presumptive intron sequence at its 3′ end consisting of a unique, 28-bp sequence that contains a GT splice donor consensus sequence at its 5′ end, a TAA stop codon, and a cleavage/polyadenylation site that determines the 3′ end of the mRNA (Fig. 1B). Northern blot analysis using a probe complementary to this 28-bp sequence detected 2.2- to 2.5-kb but not 7-kb NRP1 mRNAs (Fig. 1C, lane 4).

Synthesis of sNRP1 Protein in PC3 Cells.

PC3 cell lysates and CM were analyzed by Western blot (Fig. 2). An antibody specific for the C terminus of the NRP1 cytoplasmic domain (α-C-term) detected a 130-kDa doublet in the lysate (Fig. 2, lane 1) that corresponds to full-length NRP1 but detected no bands in CM (Fig. 2, lane 2). On the other hand, an antibody specific for the N terminus of human NRP1 (α-N-term) detected not only 130-kDa NRP1 in the lysate (Fig. 2, lane 3) but also a single, 90-kDa protein in CM (Fig. 2, lane 4). The 90-kDa protein comigrated with recombinant protein found in the CM of CHO (Fig. 2, lane 5), AT2.1 (Fig. 2, lane 6), and AT3.1 (Fig. 2, lane 7) cells transfected with 2.2-kb sNRP1 cDNA.

sNRP1 Binds ¹²⁵I-VEGF₁₆₅, Inhibits Its Binding to Cells, and Inhibits VEGF₁₆₅ Activity.

His- and Myc-tagged recombinant sNRP1 was purified and appeared as a single band of 90 kDa as detected by SDS/PAGE and Coomassie blue staining (Fig. 3A). N-terminal amino acid sequencing of this band yielded the sequence FRNDKCGDTI, corresponding exactly to the first 10 aa after the NRP1 signal peptide (4). Recombinant sNRP1 cross-linked to ¹²⁵I-VEGF₁₆₅ in solution formed a 120- to 140-kDa doublet complex consistent with the cross-linking of 90-kDa sNRP1 and 35- to 40-kDa VEGF₁₆₅ (Fig. 3B, lane 1). sNRP1, however, did not form any complex with ¹²⁵I-VEGF₁₂₁ (Fig. 3B, lane 2), consistent with the VEGF isoform specificity of NRP1 (4).

Increasing concentrations of unlabeled VEGF₁₆₅, but not VEGF₁₂₁, inhibited ¹²⁵I-VEGF₁₆₅ binding to sNRP1 in solution (Fig. 3C). Inhibition of 97% was achieved at a molar ratio of unlabeled to labeled VEGF₁₆₅ of 100. Scatchard analysis indicated that sNRP1 binds to VEGF₁₆₅ with a K_d of approximately 5–10 × 10⁻⁹ M. Full-length NRP1 binds VEGF₁₆₅ with a K_d of approximately 3 × 10⁻¹⁰ M (14). Increasing amounts of recombinant sNRP1 inhibited ¹²⁵I-VEGF₁₆₅ binding to cells in vitro (Fig. 3D). ¹²⁵I-VEGF₁₆₅ binding to PAE-NRP1 and to AT2.1 cells was inhibited by more than 90% and 50%, respectively, at an sNRP1/¹²⁵I-VEGF₁₆₅ molar ratio of 500.

VEGF₁₆₅-induced tyrosine phosphorylation of KDR in PAE/NRP1/KDR cells was analyzed by immunoprecipitation with anti-KDR antibodies followed by Western blot with antiphosphotyrosine antibodies (Fig. 3E). sNRP1 inhibited VEGF₁₆₅-induced tyrosine phosphorylation of KDR by approximately 70%.

Detection of sNRP1 mRNA by ISH Analysis.

The sNRP1 28-bp 3′ end sequence is not contained in full-length NRP1 mRNA and is unique as determined by a search of the National Center for Biotechnology Information database. An oligonucleotide complementary to the 28-bp sequence that specifically recognized the 2.2- to 2.5-kb sNRP1 mRNAs as shown by Northern analysis (Fig. 1C, lane 4) was used for ISH (Fig. 4). Cultured PC3 cells express sNRP1 mRNA uniformly in the cytoplasm (Fig. 4A). There was no signal using a sense oligonucleotide probe as a control (Fig. 4B). A full-length NRP1 riboprobe complementary to a 750-nt 3′ UTR sequence that is absent in sNRP1 detected NRP1 in these cells (data not shown). These ISH results confirm Northern blot analysis showing that PC3 cells express NRP1 and sNRP1 mRNA species (Fig. 1C).

The distribution of sNRP1 mRNA expression was analyzed in human tissues. In liver, the sNRP1 signal was associated with hepatocytes but not veins or arteries (Fig. 4C). In kidney, the signal was associated with distal and proximal tubules but not the glomeruli (Fig. 4D). On the other hand, there was no detectable sNRP1 signal in skin (Fig. 4E) or breast (Fig. 4F). ISH also was carried out for full-length NRP1 mRNA. Unlike sNRP1, NRP1 was expressed in suprabasal keratinocytes and blood vessels of the skin (Fig. 4G) and in ductal epithelia and blood vessels of the breast (Fig. 4H). NRP1 also was expressed in liver veins and glomerular capillaries (data not shown). There was no staining in tissues with sNRP1 and NRP1 sense probes (data not shown). Taken together, these results demonstrate that sNRP1 and NRP1 have different expression patterns in a number of tissues. They also suggest that NRP1 but not sNRP1 is associated with blood vessels.

Overexpression of sNRP1 cDNA in Tumor Cells.

To determine whether sNRP1 is functional in vivo, its effects on tumor cell phenotype in vivo were analyzed. Dunning rat prostate carcinoma cell lines (11) transfected with sNRP1-pcDNA3.1 secreted sNRP1 as analyzed by Western blot (Fig. 2, lanes 6 and 7). Cells transfected with pcDNA3.1 alone (AT2.1-neo, AT3.1-neo) did not express sNRP1 (data not shown). Tumor cells expressing sNRP1 grew in vitro at the same rate as control cells, and there was no visible effect on phenotype. AT2.1 cells expressing sNRP1 (AT2.1-sNRP1) and control AT2.1-neo cells were injected s.c. into rats, and tumors were excised after 3 weeks. AT2.1-sNRP1 tumors were characterized by having a small, outer rim of viable, dividing tumor cells but a large, hemorraghic center filled with fluid and blood (Fig. 5A), with very little proliferation occurring as measured by PCNA analysis (Fig. 5C) and with mostly apoptotic cells as measured by TUNEL assay (Fig. 5E). On the other hand, AT2.1-neo tumors were solid and vascular (Fig. 5B), contained a high proportion of proliferating cells (Fig. 5D), and showed very little apoptosis (Fig. 5F).

AT3.1-neo and AT3.1-sNRP1 cells were injected orthotopically into the prostates of rats, and tumors were excised after 3 weeks. The AT3.1-sNRP1 tumors were mostly TUNEL-positive, with only a thin, outer rim consisting of viable tumor cells (Fig. 5G) whereas the AT3.1-neo tumors were mostly TUNEL-negative (Fig. 5H).

The distribution of blood vessels was analyzed in these tumors. von Willebrand factor-positive EC were found in the healthy tumor rims but were greatly diminished in the apoptotic centers of the tumors expressing sNRP1 (data not shown). Furthermore, the blood vessels in the TUNEL-positive regions were damaged and disrupted, thereby contributing to hemorrhage (data not shown). Together, these results suggest that sNRP1 expression has an adverse effect on blood vessel number and integrity.