Deficiency in Expression of the Signaling Protein Sin/Efs Leads to T-Lymphocyte Activation and Mucosal Inflammation

Mice.

A bacterial artificial chromosome (BAC) mouse genomic library containing DNA derived from embryonic stem cells of strain 129/SvJ (Incyte Corp.) was screened for the Sin locus. Four BAC clones containing the Sin genomic locus were identified through hybridization to a cDNA probe spanning the entire coding region (amino acids 1 through 560; bp 1 through 1680) of Sin. The BAC clones were used to amplify sequences comprising the 5′ and 3′ arms of the targeting construct. The sequence for the primers was obtained from two contiguous sequences obtained from the ENSEMBL mouse genome database. The 5′- and 3′-arm PCR primers containing XhoI and KpnI sites were SinKO 5′-arm forward primer (GTCCATCTCGAGCCTGCAAAGTCAGCGTGCTCAAACCGC), SinKO 5′-arm reverse primer (TACCTACTCGAGGGCTCTGTTTCGCTGACTTCAAGCGATG); SinKO 3′-arm forward primer (TAGCTAGGTACCCAGGAACTGTCCTTCCGCCGAGGGGATGTT), SinKO 3′-arm reverse primer (GTCCATGGTACCGAGTAGGGTGGTAAAGCGTAGGGCCTG). The 5′ arm of the targeting sequence was cloned in an XhoI site, while the 3′ arm was cloned in a KpnI site. The targeting construct was electroporated into embryonic stem cells, and after antibiotic selection, four targeted clones were isolated. One of these clones was injected into blastocysts, which were then surgically implanted into recipient Swiss Webster mice. Male chimeric mice were then bred to C57BL/6J and 129/Sv females to establish mixed (C57BL/6J × 129/SvJ) as well as pure (129/SvJ) strains of mice. Germ line transmission of the targeted Sin locus was confirmed by analyzing tail DNA through PCR and Southern blot analysis. Animals were bred and maintained in a Columbia University animal facility under specific-pathogen-free (SPF) conditions and Institutional Animal Care and Use Committee guidelines. Animals in a C57BL/6J × 129/SvJ background as well as a 129/SvJ background were used in this study with similar results.

PCR and Southern blot analysis.

The long-template PCR kit (Roche) was used for PCR genotyping. Two 5′ primers for the Sin wild-type locus (GAGGAGGAGTGTGCCCTCCATGACGCTGGCAGG) and the targeted locus (ATGGGATCGGCCATTGAACAAGATGGATTG) were used for amplification. The 3′ primer for both loci was GGGACATGATGAGCCAGGCTGGGTGGGAGATGC. For Southern blot analysis, 5 μg of purified tail DNA was loaded on a 0.8% Tris-borate-EDTA agarose gel and run overnight at 30 V. The DNA in the gel was then depurinated in 0.25 N HCl, and DNA was transferred onto a nylon membrane (Nytran SPC; Schleicher & Schuell) overnight by capillary action in transfer buffer (0.4 N NaOH, 1 M NaCl). Posttransfer, the membrane was soaked in 2 × SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), dried, and UV cross-linked. Hybridization was carried out in Ultrahyb buffer (Ambion, Inc.) with 0.5 × 10⁶ cpm/ml of radiolabeled probe.

Flow cytometry analysis.

A total of 10⁶ freshly isolated thymocytes, splenocytes, or lymph node cells from 6- to 8-week-old mice were incubated with the specified antibodies and stained in MACS buffer (2 mM EDTA, 0.03% NaN₃, 1% bovine serum albumin, 1× phosphate-buffered saline [PBS]) for 15 min on ice. Cells were spun down and washed three times with MACS buffer, fixed in BD Cytofix buffer (BD Pharmingen), and analyzed by flow cytometry using a FACSCalibur and CELLQUEST software (BD Biosciences). Anti-CD4-allophycocyanin (APC)-, anti-CD8-peridinin chlorophyll a protein (PerCP)-, anti-CD3-fluorescein isothiocyanate (FITC)-, anti-CD69-FITC-, anti-CD5-FITC-, anti-T-cell receptor β (TCR-β)-FITC-, anti-CD62L-FITC-, anti-CD44-PE-, and anti-CD45-R(B220)-APC-conjugated antibodies were purchased from BD Pharmingen.

Immunoprecipitations and Western blots.

These assays were performed as previously described (2). Mouse monoclonal antibody against Sin was obtained from BD Transduction Laboratories.

T-cell purification and proliferation/cytokine assays.

Splenic CD4⁺ T cells were purified by using the Dynabead/DETACHaBEAD mouse CD4⁺ system (DYNAL Biotech). This protocol routinely yielded CD4⁺ T-cell populations that were >95% pure, determined by staining cells with anti-CD4 antibody and analyzing them by fluorescence-activated cell sorting (FACS). A total of 1 × 10⁵ to 2 × 10⁵ CD4⁺ T cells per well of a 96-well plate were plated. Cells were left untreated or induced with plate-bound mouse anti-CD3ɛ, anti-CD3ɛ/CD28 antibodies, or phorbol myristate acetate (PMA) and ionomycin. To measure proliferative responses, 48 h after stimulation, cells were labeled overnight with 1 μCi [³H]thymidine, and T-cell proliferation was determined by levels of [³H]thymidine incorporation on a scintillation counter. To measure cytokine secretion, culture supernatants were collected at 24 (IL-2) or 48 h and assayed for cytokine secretion by using a Luminex cytokine/chemokine sixplex bead and enzyme-linked immunosorbent assay (ELISA) kits according to the manufacturer's protocol (Biosource).

ELISAs.

To measure T-cell-dependent responses, mice were immunized with 100 μg NP-keyhole limpet hemocyanin (KLH) by intraperitoneal injection, and blood was collected on day 14 after injection. NP₁₂-bovine serum albumin-coated plates were incubated with serially diluted sera for 2 h at 37°C. After washing the plates the levels of NP-specific immunoglobulin (Ig)-isotype production in response to immunization were determined using an isotype-specific ELISA kit (Southern Biotech) containing anti-isotype-specific secondary antibodies and anti-IgH-IgL for total Ig detection according to manufacturer's protocol and as previously described (41, 43). Titration curves of the different dilutions were constructed by measuring the absorbance of alkaline phosphatase color reactions at 405 nm. Antibody presence was expressed as absorbance at 405 nm from the 1:300 (or 1:3,600 in the case of IgG1) dilution, which was within the linear part of the titration curve. For statistical analysis, Student's t test was used to calculate statistical significance for differences in measurements between two different groups. A P value of <0.05 was considered statistically significant. Serum Ig levels from unimmunized aged mice were determined using the same isotype-specific ELISA kit (Southern Biotech).

Histological analysis.

Various organs removed from aged mice were fixed in 10% buffered formalin and embedded in paraffin. Sections were stained with hematoxylin and eosin (H&E) and examined under a microscope with the help of a pathologist. The severity of the lesions was determined by light microscopy and staining of small intestine sections with anti-CD3 and anti-kappa light chain antibodies to determine the extent of infiltration and expansion/damage of villi. To classify severity of mucosal lesions, three distinct stages of villous damage relating to the extent of epithelium and lamina propria destruction were taken into consideration (mild, moderate, and severe).

Immunohistochemistry.

Immunohistological staining was performed on paraffin-embedded or frozen sections of various organs by using alkaline phosphatase (AP)-, horseradish peroxidase (HRP)-, or fluorophore-conjugated secondary antibodies. For staining paraffin-embedded sections, slides were deparaffinized with xylene, washed with ethanol, and after antigen retrieval (boiling for 15 min, in 1 mM EDTA, pH 7.5, followed by methanol washes), slides were blocked in 5% dry milk in TBST (0.05 M Tris, pH 7.5, 0.15 M NaCl, 0.01% Tween 20) and incubated with primary antibodies (anti-CD3 [Dako], anti-kappa light chain [Cortex]) overnight at room temperature (RT) in a humidified chamber. Slides were then washed with TBST and incubated with AP- or HRP-conjugated secondary antibodies for 30 min at RT. After washing in TBST specific staining was visualized by incubating slides in developing solutions nitroblue tetrazolium/BCIP (5-bromo-4-chloro-3-indolylphosphate) (AP; Roche) or aminoethylcarbacole (HRP; Sigma). For staining frozen sections, slides were fixed in 4% paraformaldehyde in PBS (pH 7.4) for 20 min, washed with PBS, and permeabilized/blocked with permeabilization buffer (RPMI medium, 0.05% saponin, 10 mM glycine, 5% normal donkey serum). After washing, the slides were incubated with primary antibodies at a 1:100 dilution (anti-CD4, -CD8, or -CD25-FITC [BD Pharmingen], or anti-F480 [Serotech]) and incubated for 30 min at RT. After a washing, slides were incubated with anti-rabbit antibody-AlexaFluor 488 (Molecular Probes) or anti-rat antibody-rhodamine (Jackson ImmunoResearch) at a 1:400 dilution for 30 min at RT, and specific staining was visualized by fluorescent microscopy using a Nikon eclipse E600 microscope.

Generation of Sin-deficient mice.

To explore the physiological role of Sin in T-lymphocyte function we generated mice deficient in Sin expression by homologous-recombination-mediated gene targeting. The targeting strategy involved insertion of a neomycin resistance cassette into the Sin locus, replacing a 4.3-kb fragment containing the first exon, the first intron, and a short portion of the second exon (Fig. 1A). The deletion was confirmed by analyzing tail DNA by Southern blots using a 5′ probe outside the targeted region and by PCR (Fig. 1B, left and right panels, respectively). The absence of Sin protein expression in knockout animals was confirmed in cell extracts from the brain and thymus, which normally express high levels of Sin (Fig. 1C) (3).

Normal T- and B-cell development but enhanced effector immune responses in Sin-deficient mice.

Sin homozygous mice develop normally and are born at normal Mendelian frequencies. To examine the role of Sin deficiency on T-cell maturation, thymocyte and splenic T-cell suspensions were analyzed by flow cytometry for expression of the CD4/CD8 coreceptors and maturation/activation markers (4, 5). The CD4⁺ and CD8⁺ T-cell percentages in the thymus (Fig. 2A) and the ratio of B cells to T cells (Fig. 2B, top panels), as well as the percentages of CD4⁺ and CD8⁺ T cells in the spleen of Sin-deficient mice, were normal compared to those of wild-type littermates (Fig. 2B, bottom panels). Total CD3, TCR-β, CD5, CD69, CD62L, CD44, and CD25 levels in thymocytes and splenic T cells from Sin knockout animals were similar to those in thymocytes and splenic T cells from wild-type controls (Table 1; data not shown). Development of B cells assayed by IgD/IgM, CD23/CD21, and B220/IgM antibody staining was normal in Sin^−/− mice (data not shown).

We have previously shown that Sin overexpression inhibits T-cell activation and IL-2 production (11, 49). Therefore, we tested the effect of Sin deletion on T-cell proliferation and cytokine secretion in vitro. Purified CD4⁺ T cells were stimulated with plate-bound antibodies against the TCR and the CD28 costimulatory receptor or PMA and ionomycin. Proliferation was subsequently assayed by thymidine incorporation, while culture supernatants were analyzed for cytokine concentrations. We found that whereas proliferation was normal (Fig. 2C), the cytokine responses of Sin^−/− T cells were enhanced in response to TCR stimulation, shown by increased production of IL-2 (5-fold) as well as cytokines of the Th₁ (IFN-γ [2-fold]) and Th₂ (IL-4 and IL-5 [∼4-fold]) T-cell lineages (Fig. 2D). In contrast, T cells stimulated with PMA-ionomycin, a nonphysiological stimulus that bypasses the TCR, behaved no different that wild-type controls (Fig. 2D).

To characterize the in vivo function of Sin-deficient T cells, we tested the T-cell-dependent antibody responses of normal and Sin-deficient mice. Mice were immunized with NP-KLH, and antibody levels in the sera of different mice were analyzed by ELISAs. In Sin-deficient mice, most NP-specific immunoglobulin isotype levels were similar to those of wild-type controls (Fig. 2E). However, significant increases were observed in the levels of IL-4- and transforming growth factor β/IL-5-dependent IgG1 and IgA isotypes, respectively (38), which correlated with the enhanced IL-4/IL-5 cytokine production by Sin-deficient T cells (Fig. 2D). A concomitant significant increase in total Ig levels was also observed in the sera of Sin^−/− mice compared to controls (Fig. 2E). The basal levels of serum immunoglobulin isotypes before immunization were within the normal range in all animals tested (Fig. 2E). Taken together, these data suggest that endogenous Sin plays an inhibitory role in T-lymphocyte function which is consistent with our previous studies showing a negative effect of Sin overexpression in T cells.

Spontaneous enteropathy in aged Sin-deficient mice.

Previous studies on adapter proteins expressed in T cells have shown that the deletion of negative regulators in most cases results in increased proliferative responses and development of spontaneous autoimmunity in older mice (9, 17, 23, 28, 30, 37, 42, 47). To address the effect of Sin deficiency on development of spontaneous autoimmunity or inflammation, histopathological analyses were performed in older mice ranging in age from 7 to 14 months. While inflammatory infiltrates were detected in H&E sections of several organs derived from Sin^−/− mice (see Table 3 below), we found that one of the tissues most seriously and consistently affected was the small intestine (Fig. 3A). H&E-stained sections of the duodenum/proximal jejunum revealed crypt hyperplasia and marked lymphocytic infiltration of the lamina propria, correlating with various degrees of damage in the intestinal mucosa of Sin^−/− mice compared to intact wild-type controls (Fig. 3A, compare left and right panels). Interestingly, sections derived from heterozygous littermates exhibited an intermediate phenotype manifested as shortened, blunt villi, expanded laminae propriae, and enlarged crypts (Fig. 3A, middle panels).

The effects of Sin deficiency on villus expansion and damage were analyzed in multiple mice and classified according to their severity. While wild-type mice had normal mucosa, most heterozygote mice (6/8, 75%) had villi with expanded laminae propriae, of which a small percentage (∼30%) also exhibited mild destruction at the tips of their villi. More dramatically, the majority (5/7, ∼70%) of Sin-deficient mice exhibited marked infiltration of the lamina propria accompanied by moderate (3/5) or severe (2/5) villus destruction (Table 2; Fig. 3A, middle and bottom right panels, respectively). Similar effects were also observed in H&E sections derived from the ileum of Sin-deficient animals, ∼60% of which exhibited inflammation and expansion of the lamina propria, crypt enlargement, and altered epithelial cell morphology or damage (Fig. 3B). In all but one case, inflammation in the duodenum/proximal jejunum coincided with inflammation in the ileum. In contrast, we found no evidence of inflammation in the colon of Sin-deficient animals (Fig. 3C).

Inflammatory infiltrates in the small intestine of Sin-deficient mice consist of T and plasma B cells.

In experimental models of intestinal inflammation, villus expansion results from infiltration of the lamina propria and the intestinal epithelium by inflammatory cells, particularly lymphocytes (39, 40). To analyze the nature of the inflammatory infiltrates in the lamina propria and epithelium of Sin-deficient mice, serial small intestine sections derived from mice with extensive villus destruction (shown in Fig. 3A) and an additional set of mice with moderate villus damage were stained with anti-CD3ɛ antibody to detect the presence of T cells. Immunostaining revealed increased presence of CD3⁺ T cells in the lamina propria in sections derived from Sin^+/− and Sin^−/− mice compared to wild-type controls (Fig. 4A). The presence of CD3⁺ T cells was less evident in the small intestine of Sin^−/− mice with extensive villus damage, although dense staining was present in remnants of the villi (Fig. 4A, bottom left panel) and in mice with less extensive destruction (Fig. 4A, bottom right panel). Consistent with the increased CD3⁺ T-cell-specific staining in the laminae propriae of Sin-deficient mice, increased numbers of peripheral (splenic) CD3⁺ T cells were observed in aged mice analyzed by anti-CD3 antibody staining and flow cytometry (Fig. 4B). Splenic CD4⁺ T cells from Sin-deficient mice also exhibited increased levels of the surface marker CD44 with a concomitant decrease in CD62L expression, suggesting an activated, effector/memory T-cell phenotype (Fig. 4C). Serial sections of the same tissues used in Fig. 4A (left panels) were also stained with anti-kappa light chain antibody, which revealed increased presence of plasma B cells in a staining pattern similar to that obtained with anti-CD3 antibody (Fig. 4D). Serum concentrations of immunoglobulin isotypes were similar in aged unimmunized animals, with the exception of IgA, which showed a statistically significant threefold increase in Sin knockout animals (Fig. 4E).

Increased infiltration of the lamina propria by CD4⁺ CD25⁺ T cells in Sin-deficient mice.

While CD4⁺ T cells constitute the major infiltrating cell population in different mucosal inflammatory disease models (39), CD8⁺ T cells are not essential for disease development, although they may contribute to the maintenance of inflammatory lesions (34). However, CD8⁺ T-cell-mediated cytotoxicity has been implicated as the driving factor for the development of colitis in at least one experimental mouse model, the TNF^ΔARE mice which exhibit enhanced production of tumor necrosis factor-α (18). To further characterize the nature of the infiltrates present in the small intestine of Sin-deficient mice, serial frozen sections of small intestine were stained with CD3/CD4, CD3/CD8, or CD4/CD25⁺ antibodies and analyzed by fluorescent microscopy. Sin knockout mice exhibited marked infiltration of the lamina propria by CD4⁺ T cells, which correlated with shortening and expansion of the villi (Fig. 5A, top right panel). The effect of Sin deficiency on infiltration of the lamina propria and intestinal epithelium by CD8⁺ T cells was less dramatic but consistent, particularly in the case of Sin heterozygous mice which exhibited significant differences in the presence of intraepithelial (IE) CD8⁺ T cells compared to controls (Fig. 5B). Costaining of the same sections with anti-CD3 and anti-CD4 or -CD8 antibodies and merging of the fluorescent images revealed that the infiltrates in the lamina propria consisted mostly of CD3⁺ CD4⁺ T cells, whereas CD3⁺ CD8⁺ cells were prominent in the intestinal epithelium (Fig. 5A and B, bottom right panels, and bar graphs in Fig. 5A).

As described for Fig. 2 above, we found that Sin^−/− T cells exhibit enhanced immune responses suggesting an activated state for these cells. Activated CD4⁺ T cells have been known to express on their surface markers such as CD69 and the IL-2 receptor CD25 in response to TCR stimulation. Thus, we tested whether the infiltrates we observe in Sin^+/− and Sin^−/− small intestine correlate with the presence of activated CD4⁺ T cells in the lamina propria. Costaining cells with anti-CD4 and anti-CD25 antibodies and merging of the images revealed increased presence of CD4⁺ CD25⁺ T cells in the laminae propriae of Sin heterozygous and knockout mice with less severe villus destruction (Fig. 5C, bottom right panel).

Sin-deficient mice develop liver granulomas.

In addition to the effects of Sin deficiency in the gut, inflammatory infiltrates were also found in the liver of ∼70% (5/7) of Sin knockout animals. Inflammation in the liver consisted of infiltrates present around hepatic vessels and granulomas arising as multiple foci within the parenchyma (Fig. 6A). Granulomas in humans and mice arise as a result of diverse etiologies, are epithelioid in nature, and consist of both T cells and macrophages (21). Analysis of the cellular composition of liver sections with anti-CD3ɛ antibody staining revealed the presence of CD3⁺ T-cell infiltrates in the liver of Sin knockout mice but not in wild-type controls (Fig. 6B). Staining of liver sections with the macrophage antigen F4/80 also revealed the presence of these cells in the granulomas (Fig. 6C). Liver granulomas coincided with the presence of infiltrates/damage in the small intestine in all cases examined suggesting a common link in the development of these inflammatory lesions. Inflammatory infiltrates were also found in the kidneys of most knockout animals that also developed intestinal and liver inflammation. Other tissues, such as the lung and skin, were less affected, and in some but not all cases, the lung inflammation occurred independently from that observed in the small intestine (Table 3).