iBet uBet web content aggregator. Adding the entire web to your favor.
iBet uBet web content aggregator. Adding the entire web to your favor.



Link to original content: https://pubmed.ncbi.nlm.nih.gov/9037021/
Sequence-specific RNA binding by an SR protein requires RS domain phosphorylation: creation of an SRp40-specific splicing enhancer - PubMed Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 1997 Feb 18;94(4):1148-53.
doi: 10.1073/pnas.94.4.1148.

Sequence-specific RNA binding by an SR protein requires RS domain phosphorylation: creation of an SRp40-specific splicing enhancer

R Tacke  1 , Y Chen, J L Manley
Affiliations

Sequence-specific RNA binding by an SR protein requires RS domain phosphorylation: creation of an SRp40-specific splicing enhancer

R Tacke et al. Proc Natl Acad Sci U S A. .

Abstract

We showed previously that ASF/SF2, a member of the SR protein family of splicing factors, can activate a splicing enhancer element composed of high-affinity ASF/SF2 binding sites. To determine whether other SR proteins can behave similarly, we selected a high-affinity RNA-binding site (B1) for the SR protein SRp40. Strikingly, the success of this selection was completely dependent on phosphorylation of the RS domain, as unphosphorylated SRp40 failed to select specific sequences. We show that three copies of B1 function as a strong splicing enhancer, activating an intron with suboptimal splicing signals in nuclear extracts. Enhancer activity in S100 extracts (which lack SR proteins) required SRp40 and a nuclear fraction previously found to be required for ASF/SF2-dependent splicing. Importantly, enhancer activity was lost when SRp40 was replaced by ASF/SF2 or SC35, and SRp40 was the only classical SR protein found to be associated with the enhancer. Together, our results indicate that phosphorylation-dependent, sequence-specific RNA binding can impart unique activities to individual SR proteins.

PubMed Disclaimer

Figures

Figure 1
Figure 1
In vitro phosphorylation of HSRp40 in HeLa S100. (A) Coomassie stain of 3 μg of purified HSRp40 (lane 1), and of in vitro phosphorylated HSRp40 (ph.HSRp40) after repurification from S100 (lane 2). Proteins were resolved by SDS/9% PAGE. Molecular mass markers are shown on the left. (B) Western blot analysis with mAb104 of 150 ng of purified rSRp40 (lane 1), HSRp40 (lane 2), and in vitro phosphorylated HSRp40 (lane 3).
Figure 2
Figure 2
Identification of a high-affinity RNA-binding site for SRp40 by SELEX with in vitro phosphorylated HSRp40. The sequences of individual clones selected after the indicated cycles are presented. Nucleotides shown in lowercase characters belong to the flanking constant region. Numbers on the right indicate the number of times each sequence was recovered. Nucleotides that contribute to the consensus sequence (bottom) are represented in boldface.
Figure 3
Figure 3
Gel mobility-shift assays of rSRp40 and GSRp40ΔRS. Radiolabeled RNA probes were incubated with increasing concentrations of rSRp40 (3, 15, and 75 nM) (A) or GSRp40ΔRS (8, 40, and 200 nM) (B). Free RNA and RNA-protein complexes were resolved by a 5% polyacrylamide nondenaturing gel. The sequences of H6 and H12 are GGGAGGAATGTCGCGTTCGGA and CGGAATGTCTTTACACTAC, respectively. For identification of other sequences, see Fig. 2 and ref. (A7, C2).
Figure 4
Figure 4
Authentic SRp40 present in NE binds efficiently to B1 RNA. (A) UV cross-linking of B1 RNA in NE (lane 1), S100 (lane 2), and S100 supplemented with 50 nM SRp40 (lane 3). Before irradiation with UV, radiolabeled B1 RNA was incubated for 30 min under splicing conditions. Cross-linked proteins were resolved by SDS/10% PAGE. (B) Western blot analysis with mAb104 of proteins selected by biotinylated B1 RNA, from NE (lane 4), S100 (lane 5), and S100 supplemented with 50 nM rSRp40 (lane 6). A fraction of the corresponding input material is shown in lanes 1–3.
Figure 5
Figure 5
Three copies of a high-affinity SRp40 binding site (B3) function as a splicing enhancer in vitro. (A) B3 contains three copies of the variable sequence of B1 (boldface) plus six nucleotides of the 5′ flanking region (underlined). (B) In vitro splicing of enhancer test substrates GN-A3, GN-B3as, and GN-B3 (see text). In vitro splicing was performed for the indicated times. Splicing products and intermediates are indicated schematically. (C) In vitro splicing of GN-B3 for 2 h in NE (lane 1), S100 (lane 2), NF20–40 (lane 3), as a combination of S100 and NF20–40, supplemented with no protein (lane 4), recombinant SRp40 (lane 5), ASF/SF2 (lanes 6), SC35 (lane 7), or SR proteins purified from NE (lane 8). (D) In vitro splicing of Pip7A (see ref. 32) for 90 min in NE (lane 1) and S100 supplemented with the indicated SR proteins (lanes 2–5). The concentrations of recombinant SR proteins used were 50 nM in all experiments.
Figure 6
Figure 6
SRp40 is the only SR protein selected efficiently from NE by B3 RNA. Western blot analysis of proteins selected by biotinylated B3 RNA using mAb104. Proteins were selected from NE (lane 1), NF20–40 (lane 2), S100 (lane 3), or S100 supplemented with 50 nM rSRp40 (lane 4). The migration of SR proteins present in NE (not shown) is indicated at right.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Baker B. Nature (London) 1989;340:521–524. - PubMed
    1. Valcárcel J, Singh R, Zamore P D, Green M. Nature (London) 1993;362:171–175. - PubMed
    1. Inoue K, Hoshijima K, Higuchi I, Sakamoto H, Shimura Y. Proc Natl Acad Sci USA. 1992;89:8092–8096. - PMC - PubMed
    1. Tian M, Maniatis T. Science. 1992;256:237–240. - PubMed
    1. Tian M, Maniatis T. Cell. 1993;74:105–114. - PubMed

Publication types