iBet uBet web content aggregator. Adding the entire web to your favor.
iBet uBet web content aggregator. Adding the entire web to your favor.



Link to original content: http://www.addgene.com/35227/
Addgene: LOC566040_ L (OZ587) Skip to main content
Addgene

LOC566040_ L (OZ587)
(Plasmid #35227)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35227 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    MG414
  • Backbone size w/o insert (bp) 5493
  • Vector type
    Zebrafish Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    Requires a bacterial strain such as XL1 Blue, that expresses the lacIq allele of lac repressor
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Zinc finger array targeting LOC566040
  • Alt name
    LOC566040
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    270
  • Entrez Gene
    LOC566040

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer OK.61 GGGTAGTACGATGACGGAACCTGTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene LOC566040. Please note that this plasmid does NOT contain the LOC566040 sequence.

Users must order the complementary plasmid LOC566040_R (OZ588) [Addgene plasmid 35228] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene.

Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290/292 (Addgene plasmids 21872 & 21873), pMLM800/802 (Addgene plasmids 27202 & 27203).

The difference between pMLM800/802 and pMLM290/292 is the length of the “spacer” sequence in the full ZFN target site. If the spacer is 7 bp, scientists should use pMLM800/802. If the spacer is 5 or 6 bps, scientists should use pMLM290/292.

pMLM290/292 is identical to pST1374 except that it harbors two mutations in the FokI nuclease domain (Q486E, I499L; aka the “-“ mutation see Miller et al., Nat. Biotech 2007, PMID 17603475) which confers heterodimeric behavior on these domains

This zinc finger array was tested for binding activity to the sequence 5'-GCTGGTGCT-3' in a bacterial two hybrid assay, and resulted in 7.5 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus).

Scientists using this zinc finger array in a publication should notify [email protected] and acknowledge NIH grant number R01 GM088040 in the publication.

Other Articles: "Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082)

"Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LOC566040_ L (OZ587) was a gift from Keith Joung (Addgene plasmid # 35227 ; http://n2t.net/addgene:35227 ; RRID:Addgene_35227)

  • For your References section:

    Rapid "open-source" engineering of customized zinc-finger nucleases for highly efficient gene modification. Maeder ML, Thibodeau-Beganny S, Osiak A, Wright DA, Anthony RM, Eichtinger M, Jiang T, Foley JE, Winfrey RJ, Townsend JA, Unger-Wallace E, Sander JD, Muller-Lerch F, Fu F, Pearlberg J, Goebel C, Dassie JP, Pruett-Miller SM, Porteus MH, Sgroi DC, Iafrate AJ, Dobbs D, McCray PB, Cathomen T, Voytas DF, Joung JK. Mol Cell. 2008 Jul 25. 31(2):294-301. 10.1016/j.molcel.2008.06.016 PubMed 18657511
Related items: